Libre Calc Exceeding Limit

hi guys, im having terminal trouble.

i have a libre word file called lintest.odt in the Documents directory (folder). I want to move it to the Libre directory (folder).

Desktop Downloads Libre Pictures Templates
Documents home Music Public Videos


from the root directory i typed cd Documents and then pwd and I got
/home/francis/Documents
i then typed ls and i got lintest.odt

I then typed mv lintest Libre and it says

mv: cannot stat ‘lintest’: No such file or directory

what am I doing wrong?

when i try to see the contents of the lintest file with more lintest
I got ~/Documents$ more lintest.odt
PK
�F^�2^L'
--More--(0%)
and then it locks up the terminal.

im obviously doing something dreadfully wrong.

Hi guys,

I have multiple .csv files with multiple columns/headings, set up essentially like this (obviously more info in the real thing)


Gene Location Ref Var Coverage Function
DMD chrX.... A G 198 exonic
SCN4A chr17.... T C 111 splicing

and so on...

How could I concatenate selected columns into an output file with strings seperated with a comma? eg DMD,A,G,exonic (similar to what you can do in excel). I would like to be able to do this for multiple files in a directory. It would be preferable if all the outputs could be compiled into one file as I'll use this for something else later.
The current protocol in our team is to concatenate each file individually with an excel macro and copy into a file, and it takes a very long time.

Thanks very much!!

(Raspberry Pi Model B)
I have a really long audio file I'd like to play.
It's 10 hours long (white noise)

However, when playing it with mplayer it only gets to 4 hours before determining it's now end of file.

Code:

A:14360.8 ( 3:59:20.8) of 36080.8 (10:01:20.7)  7.2


Exiting... (End of file)

I know the audio file isn't corrupted past this point since I can fast-forward to 3:59:00:0 and let it play and it works fine (at least for the 2m I let it play)

I could in theory break up the file into 3.5 chunks to stay below the limit but I'm wondering if this is a inherent limitation of mplayer (didn't expect 4hr+) or if it's a bug.

Hello There


I have an issue in file permission,I have configured an samba share drive,
created user and then shared it with other network computer(WINDOWS 7)

whenever an user creates an folder or file (like Excel) it shows up in read only mode..

I have ran the command :- chmod -R 777 <sharedFolder>

still when the users create a new folder, other cannot edit or modify the file

need help

Tiny font when printing Libre Writer doc.
Using Mint 17.1, HP Officejet Pro 8610
Print is so tiny it is illegible, even though font size selected is 12. Printing a text file, gedit, prints okay.
Also, if I export the .odt doc to .pdf, it prints okay.
Any suggestions would be appreciated. I just dumped Win7 OS and am learning Linux.

Hello.

I have such links in a web site

/post.php?id=14
/cat.php?t=y&cid=6666

and i create an .htaccess file with that content inside.

Code:

Options +FollowSymLinks 
RewriteEngine On 
RewriteRule ^([^/]*)$ /post.php?id=$1 [L] 
RewriteRule ^([^/]*)/([^/]*)$ /cat.php?t=$1&cid=$2 [L]

but on refresh, apache returns 500 Internal server error.

I looked on logs and found that :
Quote:
AH00124: Request exceeded the limit of 10 internal redirects due to probable configuration error. Use 'LimitInternalRecursion' to increase the limit if necessary. Use 'LogLevel debug' to get a backtrace.
Why that happens ? Mod_rewrite is enabled in httpd.conf.

Hi!

I have a fasta file with biological DNA sequences.
Fasta files are build like this:
>This_is_a_FASTA_header
TTTATATATAGACGATGACGATGACA
>The_next_sequence_begins
GGGCACAGTAGCAGA
>And_another
TGCGAGAGGTAGTAGAT

In my case all the header lines (starting with ">") have one 360 indices starting after the ">:
>001_blabla
....
>360_blabla

I want to split my big combined fasta file into 360 single files with sequences sharing the same index.

Thank you very much!

Is it possible to limit maximum number of user accounts?

My kernel version is 2.6.32. So It can support 4 billion user accounts now
But I hope to limit the quantity

I believe there is some ways to fix this, but I can't find the solution by myself.

from the desk top i open documents file , i have multiple folders but no information Clearly what iam see is the background. how do i fix this perhaps i have deleted some thing wwhich has created the problem .

OPENING A FILE i receive multiple notification from OKULAR SAYING CANNOT OPEN FILE AND QUOTES FILES WHICH HAD BEEN DELETED .
ANY SUGGESTION ON HOW I CAN FIX THE DEFECTS .

On a fresh install of Arch with little more than openbox installed when I try to startx as a regular user this is the feedback I get:
xauth: timout in locking authority file /home/tim/.Xauthority
xauth: timout in locking authority file /home/tim/.Xauthority
xauth: timout in locking authority file /home/tim/.Xauthority
xauth: timout in locking authority file /home/tim/.Xauthority
Fatal server error:
(EE) cannot open log file "/home/tim/.local/share/xorg/Xorg.0.log"
xinit: giving up
xinit: unable to connect to X server: Connection refused
xinit: server error
xauth: timeout in locking authority file /home/tim/.Xauthority

After looking into the error someone suggested to copy the file from root user. When I try to view, less, or open the file I get strange feedback "magic cookie" and then everything starts to trip out and I cant seem to reverse it without a reboot.