[Kali Linux] How Do I Split A 15.7GB Text File Into 3 Parts Also...

Hi
please see the file attached.
then how we can omit these parts with command on linux ?




thank you.

Hello,

I apologize in advance for my limited UNIX scripting knowledge. I am new to it and really want to learn.

I am trying to write a bash script that updates a config file based on user input.

What is the best method for accomplishing this? I need it to prompt the user for two variables, find the location in the config file, and insert new text with the two variables.

I was thinking I could use sed to find the text in the config file where the new text must be inserted before and replace it with the new text, two variables, and same ending text as before. Example:

echo "1st variable?"
read variable1

echo "2nd variable?"
read variable2

sed -e "s|<the spot in the config file that needs new config>|sometext...$variable2_somemoretext...$variable1\n<the spot in the config file that needs new config>|g" config > config2


This works except variable2 is not inserted into the replace string, only variable1 is. This is the result in config2:

sometext..._somemoretext...$variable1
<the spot in the config file that needs new config>


If anyone can tell me why variable2 isn't working in the sed replace string, or if there's a much better way for accomplishing what I'm after, I'd appreciate any help I can get.

Could someone that is using Kali Linux please send me their bash.rc file?! I accidently screwed mine up and I can't reset it back to default. Thanks.

Hi all,

I have a device which has a Compact Flash card and a SSD. The file system is split so that everything except "/home" is stored on the compact flash card.

On the compact flash I am experiencing partition table corruption due to power loses when writing to the CF card.

One solution to this is to move everything onto the solid state drive, but as this is also flash memory - is the rish of corruption still the same as using the CF card?

Thanks in advance for any replies.

Hi everyone, I am a new member and also new to linux, I encountered a problem, but last week I tried but did not solve
I downloaded iso file linux 1.1.0 on page potassium https://www.kali.org, I installed on my Dell inspiron n4010, it works very well and does not have any errors, but after I update and upgrade all packages, I rebooted the system switches to the command line, I lost a lot of time to return to the graphics, but when booting up the network manager icon not seen, I have set the package network-manager-gnome_0.9.4.1-0ubuntu2_i386.deb network manager icon show but when click on the network manager icon only contained text "network manager is not running."
I also installed Wicd but could not run "could not connect to wicd's D-Bus interface. Check the wicd log for error messages."
wireless driver apparently was set before
root@kali:~# airmon-ng
PHY Interface Driver Chipset

phy0 wlan0 wl Broadcom Corporation BCM4313 802.11b/g/n (rev 01)

please help me!
please guide installed offline, my kali linux no internet connection. can download package from another machine to install.

Hi!

I have a fasta file with biological DNA sequences.
Fasta files are build like this:
>This_is_a_FASTA_header
TTTATATATAGACGATGACGATGACA
>The_next_sequence_begins
GGGCACAGTAGCAGA
>And_another
TGCGAGAGGTAGTAGAT

In my case all the header lines (starting with ">") have one 360 indices starting after the ">:
>001_blabla
....
>360_blabla

I want to split my big combined fasta file into 360 single files with sequences sharing the same index.

Thank you very much!

Ladies & Gents

So in the process of coping some text out of html files in konqueror into kwrite I discovered that it will drag and drop the text after it is selected. The problem is that when I try to open the file saved in kwrite it is in a strange encoding that is not readable. There are a lot of these files that are now corrupt. Does anybody know how to re-encode the files so I don't have to regenerate them

Thanks

I have a bash script executing on an AIX server to a windows share directory to update a windows text file. Most of the file is edited as expected but I have 3 issues that I am not sure how to resolve.

1. Windows text file contains a double backslash (\\) and the \\ is being written back as a single \ which corrupts the file.
2. I am not getting the last line of text in the file written back out.
3. Some lines of text are not written back out completely.

Here is a snippet of my bash script:
cp $Directory/Somefile $Directory/Somefile.$(date +'%Y%m%d')
cat /dev/null > ${HOME}/temp.out

while read -r inpLine; do
patternFound=n
echo ${inpLine} | grep -q 'SOMEPATTERN='
if [ $? = 0 ]; then
patternFound=y
echo "##${inpLine}" >> ${HOME}/temp.out
echo "SOMEPATTERN=newValue" >> ${HOME}/temp.out
fi

if [ ${patternFound} = "n" ]; then
echo ${inpLine} >> ${HOME}/temp.out
fi

done < $Directory/Somefile
mv ${HOME}/temp.out $Directory/Somefile

hello , can any one know about passwd.client which is in /etc/exim4/passwd.client file. in this file there are two fields
email and password as plain text eamil as a plain text is ok but password as a plain text not okey .
I want to know how to encrypt that pasword or hide like ***** in pasword field ..does anybody can help me with this ...i am new to this

I have the following code to extract two dates using awk, which are then read into two awk variables new and old respectively.
Each dates on the html file pulled with curl request is in this format:
2015-04-06 09:40:37
And two are being extracted
However the strings are being split on white space within the date strings. I tried changing OFS to ',', but it was still splitting incorrectly.
Code:

read dateStrNew dateStrOld < <(curl -k -q "$curl_call" | html2text | gawk '/Newest Sequence/ { new=$3" "$4 }/Oldest Sequence/ \
 {old=$3" "$4}END {OFS=","; print new,old }')  //new = date, old = date

Both parts of the date are being assigned to each variable using $3 and $4, then the space needs to be added back in so that the string can be used afterwards with a date command.

I just can't work out what is wrong, any help would be very much appreciated! Thanks!