How To Disable Boot Messages To Be Printed On Screen During Boot Up

hello,
I have a CentOS system and I want to prevent the boot messages from appearing during bootup. I have added the quiet option in grub.conf file which hides the boot messages, but after pressing the esc key or the arrows it shows up again.

Is it possible to hide it permanently?

Or not show the boot logs when the basic(esc or arrow) keys are pressed but assign a different set of key combos which when pressed, then only the boot messages should be visible.

Thankyou

Hey guys,

I've recently started learning Linux, and I was wondering if anyone can tell me how I can search for a specific usernames starting with a certain letter on a Linux system.

For example: How do I get it to display all the usernames starting with a J? (So that it would show me, Jack, Jason, John, etc...)
I tried to find the answer online, but haven't had much luck so far.

When I start my HP laptop, which is dual booted with Windows 7 and Linux Mint 17.1 "Rebecca"(64-bit) and choose to start Mint, the logo of Linux Mint appears and then it freezes and doesn't proceed. Windows 7 is working fine. It was perfectly working for last 2 months.
(My battery back-up is low and cannot give back-up for more than 25 minutes, just mentioned it as it may be associated with this problem).
NB: When I pressed escape while showing the Mint logo at starting, some underlying(?) processes were shown. I have attached a jpg image of that screen. Hope it helps.

I created 3 test machine and made them into cluster.
On Virtual
"Virtual Machine Manager 0.9.0"
Machines them selves are CentOS 5.11.

Code:

<cluster name="mycluster" config_version="3">
   <clusternodes>
     <clusternode name="one" nodeid="1">
         <fence>
         </fence>
     </clusternode>
     <clusternode name="two" nodeid="2">
         <fence>
         </fence>
     </clusternode>
     <clusternode name="three" nodeid="3">
         <fence>
         </fence>
     </clusternode>
   </clusternodes>
   <fencedevices>
   </fencedevices>
   <rm>
   </rm>
</cluster>

When I start cman service. I see get this:

Code:

[root@one ~]# time service cman restart
Stopping cluster: 
   Stopping fencing... done
   Stopping cman... done
   Stopping ccsd... done
   Unmounting configfs... done
                                                           [  OK  ]
Starting cluster: 
   Loading modules... done
   Mounting configfs... done
   Starting ccsd... done
   Starting cman... done
   Starting daemons... done
   Starting fencing... failed

                                                           [FAILED]

real	5m7.353s
user	0m0.063s
sys	0m0.095s
[root@one ~]#

clustat:

Code:

[root@one ~]# clustat 
Cluster Status for mycluster @ Tue Jun  2 11:10:28 2015
Member Status: Inquorate

 Member Name                                            ID   Status
 ------ ----                                            ---- ------
 one                                                        1 Online, Local
 two                                                        2 Offline
 three                                                      3 Offline

[root@one ~]#

Thank you.

Hi!

I have a fasta file with biological DNA sequences.
Fasta files are build like this:
>This_is_a_FASTA_header
TTTATATATAGACGATGACGATGACA
>The_next_sequence_begins
GGGCACAGTAGCAGA
>And_another
TGCGAGAGGTAGTAGAT

In my case all the header lines (starting with ">") have one 360 indices starting after the ">:
>001_blabla
....
>360_blabla

I want to split my big combined fasta file into 360 single files with sequences sharing the same index.

Thank you very much!

hi all

I am learning systemd and how to add new services as part of the LFS201 course and I have a question about the services:
Code:

Lab 4.2: Adding a New Startup Service with systemd
For example a very minimal file named
/etc/systemd/system/fake2.service:
[Unit]
Description=fake2
After=network.target
[Service]
ExecStart=/bin/echo I am starting the fake2 service
ExecStop=/bin/echo I am stopping the fake2 service
[Install]
WantedBy=multi-user.target

Code:

root@ubuntu:/etc/systemd/system# systemctl start fake.service
root@ubuntu:/etc/systemd/system# systemctl status fake.service
 fake.service - fake
   Loaded: loaded (/etc/systemd/system/fake.service; disabled; vendor preset: enabled)
   Active: inactive (dead)

May 16 11:41:05 ubuntu systemd[1]: Started fake.
May 16 11:41:05 ubuntu systemd[1]: Starting fake...
May 16 11:41:05 ubuntu echo[1798]: I am starting the fake2 service
May 16 11:41:05 ubuntu echo[1800]: I am stopping the fake2 service
root@ubuntu:/etc/systemd/system# ps aux | grep fake*
root      1809  0.0  0.0  13688  2272 pts/8    S+   11:41   0:00 grep --color=auto fake.service
root@ubuntu:/etc/systemd/system#

as you can see the fake2 service is really only two lines. And when I grep for the service via ps I can't fine it. I guess it is because it has finished running. I am wondering how can I change it so that I can keep it running?

thanks

This morning I was watching some online TV shows on CBS.com. After watching two shows, I tried to watch a third. Instead of a video, I got a screen saying I needed to install Adobe Flash. Obviously, Adobe Flash was already installed--that's how I had watched the first two videos. I decided maybe the problem was CBS wanted a later version of Flash. That's when I ran the YUM update.

Everything seemed to download OK except for firefox. It must have been downloading from a mirror somewhere on the other side of the planet because the download rate was something like 7kb/s. The ETA was something like two hours. I decided to end that terminal session and started the YUM update over again. This time it recognized it had already downloaded all the other packages and the download for firefox was several hundred kilobytes per second. After that the update seemed to go OK.

Unfortunately, when I rebooted and chose the new kernel in the grub list, the boot appears to hang just before I'm supposed to get a login screen. Normally, booting takes only a minute or so, but now all I get is a blinking cursor in the upper left corner, even after waiting 10 minutes. I hit the power switch to turn the computer off and rebooted.

This time I hit the escape key to watch the boot progress. These are the last three lines:
[ OK ] Started Command Scheduler
Starting Terminate Plymouth Boot Screen...
Starting wait for Plymouth Boot Screen to quit...

Then it hangs. Hitting the escape key has no effect. CTRL-ALT-DEL reboots.

According to grub, the newly updated kernel version is: Fedora (3.19.5-200.fc21.x86_64) 21 (Twenty One)

I tried another YUM update. Here's the results:
[root@XXXXX ~]# yum update
Loaded plugins: fastestmirror, langpacks
Loading mirror speeds from cached hostfile
* fedora: fedora.mirrors.tds.net
* rpmfusion-free: mirror.us.leaseweb.net
* rpmfusion-free-updates: mirror.us.leaseweb.net
* rpmfusion-nonfree: mirror.us.leaseweb.net
* rpmfusion-nonfree-updates: mirror.us.leaseweb.net
* updates: repo.atlantic.net
No packages marked for update
[root@XXXXX ~]#

I had been using the video driver available on nVidia.com on the previous kernel. (That kernel still works because I'm able to type this.) It's very likely not the latest version of video driver since it has been a while since I installed it. Could this have something to do with the hang?

What should I try to do next? Thanks for reading this.

I am novice at linux...I installed VMware work station and then install centos 6.4. Now I followed this tutorial to configure DHCP Server on my OS http://tecadmin.net/configuring-dhcp...centos-redhat/
but when start dhcp I see this : Starting dhcpd:[FAILED]
This is my /etc/dhcp/dhcpd.conf

option domain-name "center.local";
option domain-name-servers master.center.local;
default-lease-time 600;
max-lease-time 7200;
authoritative;
log-facility local7;
subnet 192.168.1.0 netmask 255.255.255.0 {
option routers 192.168.1.1;
option subnet-mask 255.255.255.0;
option domain-search "center.local";
option domain-name-servers 192.168.1.100;
option time-offset -18000; # Eastern Standard Time
range 192.168.1.100 192.168.1.120;
}

host station1 {
option host-name "centos-1.center.local";
hardware ethernet 00:11:1A:2B:3C:AB;
fixed-address 192.168.1.101;
}

so what is wrong?Any suggestion?
Thanks for your help and sorry for my bad English grammar

Hi all

I am trying out this dhcp server setup on opensuse 12.1 but it does not seem to be working.

I have eth0 configured to be 192.168.10.1 in a /24 network.

I want to hand out the rest of the address in the same subnet as dhcp addresses. (So everything from 10.2 to 10.255). The default gw is defined as 192.168.10.1, and routing table looks correct. and I only have eth0.


When I start the dhcp, and connect it to the client machine, I see nothing on the wireshark trace. no DHCP discovery or ack messages. And the client machine just keeps trying boot from the network via the network interface. I know I got the right interface (there were blinky options in the bios that lets you identify the correct interface) and the cable is not a problem. (If the cable were a problem the client boot message would say "media fault ... please check media...") instead.

Here is my dhcpd.conf file. I went through man dhcpd already, and cleaned out everything that I apparently don't need. (The original file was copied from a more complicated setup that had multiple subnets and dhcp relays.)

Code:

###################simplfied 
linux-kzy1:/var/lib/dhcp/db # cat /etc/dhcpd.conf
authoritative;

ddns-update-style none;
ddns-updates off;

#Information about the host
subnet 192.168.10.0 netmask 255.255.255.0 {
  max-lease-time 600;
  default-lease-time 600;
  range 192.168.10.2 192.168.10.255;
}

group esx_gep{
  filename "pxelinux.0";
  next-server 192.168.10.1; 
  host testserver1 {hardware ethernet a0:d3:c1:f7:f2:64;}
}

this is what /var/log/message and /var/log/rc.dhcpd.log says:
Code:

**************var log message
Mar 19 18:42:17 linux-kzy1 dhcpd: For info, please visit https://www.isc.org/software/dhcp/
Mar 19 18:42:17 linux-kzy1 dhcpd: Not searching LDAP since ldap-server, ldap-port and ldap-base-dn were not specified in the config file
Mar 19 18:42:17 linux-kzy1 dhcpd: Wrote 0 group decls to leases file.
Mar 19 18:42:17 linux-kzy1 dhcpd: Wrote 0 deleted host decls to leases file.
Mar 19 18:42:17 linux-kzy1 dhcpd: Wrote 0 new dynamic host decls to leases file.
Mar 19 18:42:17 linux-kzy1 dhcpd: Wrote 0 leases to leases file.
Mar 19 18:42:17 linux-kzy1 dhcpd: Listening on LPF/eth0/84:8f:69:cf:7c:41/192.168.10.0/24
Mar 19 18:42:17 linux-kzy1 dhcpd: Sending on   LPF/eth0/84:8f:69:cf:7c:41/192.168.10.0/24
Mar 19 18:42:17 linux-kzy1 dhcpd: Sending on   Socket/fallback/fallback-net
Mar 19 18:42:17 linux-kzy1 dhcpd[12233]: Starting ISC DHCPv4 4.x Server [chroot]..done
linux-kzy1:/home/test/Documents #


*****************var log rc.dhcpd.log
Mar 19 18:42:17 linux-kzy1 dhcpd: Internet Systems Consortium DHCP Server 4.2.2
Mar 19 18:42:17 linux-kzy1 dhcpd: Copyright 2004-2011 Internet Systems Consortium.
Mar 19 18:42:17 linux-kzy1 dhcpd: All rights reserved.
Mar 19 18:42:17 linux-kzy1 dhcpd: For info, please visit https://www.isc.org/software/dhcp/
Mar 19 18:42:17 linux-kzy1 dhcpd: Not searching LDAP since ldap-server, ldap-port and ldap-base-dn were not specified in the config file
Mar 19 18:42:17 linux-kzy1 dhcpd: Wrote 0 group decls to leases file.
Mar 19 18:42:17 linux-kzy1 dhcpd: Wrote 0 deleted host decls to leases file.
Mar 19 18:42:17 linux-kzy1 dhcpd: Wrote 0 new dynamic host decls to leases file.
Mar 19 18:42:17 linux-kzy1 dhcpd: Wrote 0 leases to leases file.
Mar 19 18:42:17 linux-kzy1 dhcpd: Listening on LPF/eth0/84:8f:69:cf:7c:41/192.168.10.0/24
Mar 19 18:42:17 linux-kzy1 dhcpd: Sending on   LPF/eth0/84:8f:69:cf:7c:41/192.168.10.0/24
Mar 19 18:42:17 linux-kzy1 dhcpd: Sending on   Socket/fallback/fallback-net
Mar 19 18:42:17 linux-kzy1 dhcpd[12233]: Starting ISC DHCPv4 4.x Server [chroot]..done
linux-kzy1:/home/test/Documents #

not very interesting stuff or useful, but I found some other messages that is very interesting:

Code:

**********
#no free lease

linux-kzy1:/home/test/Documents # cat /var/log/messages | grep "free lease"
Mar 19 15:53:59 linux-kzy1 dhcpd: DHCPDISCOVER from a0:d3:c1:f7:f2:64 via eth0: network 192.168.10.0/24: no free leases
Mar 19 15:54:03 linux-kzy1 dhcpd: DHCPDISCOVER from a0:d3:c1:f7:f2:64 via eth0: network 192.168.10.0/24: no free leases
Mar 19 15:54:11 linux-kzy1 dhcpd: DHCPDISCOVER from a0:d3:c1:f7:f2:64 via eth0: network 192.168.10.0/24: no free leases
......
Mar 19 17:01:06 linux-kzy1 dhcpd: DHCPDISCOVER from a0:d3:c1:f7:f2:64 via eth0: network 192.168.10.0/24: no free leases
Mar 19 17:01:38 linux-kzy1 dhcpd: DHCPDISCOVER from a0:d3:c1:f7:f2:64 via eth0: network 192.168.10.0/24: no free leases
linux-kzy1:/home/test/Documents #

Which ties into my first question: dhcp no free lease: I googled a bit, I found a post from a guy on ubuntu who has the same error message and the suggested course of action is to change ownership of the lease file to dhcpd and give it 777 for permission. Which I thought is weird, because the lease file is automatically created by the dhcpd itself, so it really shouldn't be a permission issue shouldn't it? (Anyway, tried that didn't do a thing.) right now it is owned by root/root and has this permission: -rw-r--r--.

2nd question: once the client gets a reply from my dhcp server saying no free lease, does it remember this dhcp server as no free lease and does it persist throughout reboots? Because I tried rebooting the client a number of times and I don't see anything on the wireshark at all. You will notice the time stamp on the last "no free lease" message is not as late as the other messages from the var/log/messages or rc.dhcpd.log and I rebooted the client and the dhcp plenty of times since 17:01:38.



Thanks for all your help in advance everyone.

Ubuntu 14.10 runs great on my laptop but I think I have dependency problems because EVERY time I install or remove software I get the following error message. However everything seems to run just fine...

"Package operation failed"
"The installation or removal of a software package failed."

...and details shows a massive list of gobbledygook with a lot of:

"insserv: Starting vpnagentd_init depends on rc.local and therefore on system facility `$all' which can not be true!"

I can post the whole message but I'll wait for feedback first.